Quote

“Vaccine Encephalopathy” – Autism, Epilepsy, & Age of Onset

via “Vaccine Encephalopathy” – Autism, Epilepsy, & Age of Onset

Advertisements

tontonmichel:

bilt2tumble:

suburbanhermit:

manslator:

gh0sst-s:

manslator:

gh0sst-s:

anti-feminism-pro-equality:

manslator:

krycega:

manslator:

krycega:

anti-feminism-pro-equality:

manslator:

anti-feminism-pro-equality:

manslator:

I think the problem is the ladies of the left, the arbiters of all
reasonable human behavior, have become aware that there are still men
fouling the public arena. And even worse,these men seem to have some
sort of apparatus attached to their buttocks or somewhere down there
that requires these socially unacceptable air thieves to sit with legs
unacceptably akimbo while riding public conveyances.

Manslation: Somebody sat next to me on the bus and made me shift my legs closer together and you just can’t understand the TORTURE this inflicts on my TENDER PARTS. If my legs aren’t splayed wider than the English Channel my grapes will die and shrivel up into lil’ raisins. Also if I pepper this statement with enough big words, it might hide my misogyny.

you: “I am unaware of how biology works and don’t know men’s skeletal structure is designed so that men are more comfortable sitting with their legs wider and I ignore the fact its easier for women to close their legs and I don’t care if a woman puts her bags on the seat next to her but if a mans legs are open that’s MISOGYNY!!!”

feminists are wild

Here’s the thing. It’s already rude to put your bag on a seat when someone needs a place to sit. It is an established social standard. Also, guess what dillweed? It’s more comfortable for women to sit with their legs apart too! But sometimes, when you are on public fucking transport, YOUR COMFORT IS NOT THE PRIORITY. I don’t give two fuckin shits if you are comfortable. I’d love to flush my tampons, but I don’t, because it would be rude to clog other people’s pipes. Most of the time I’m on a crowded bus or train, I would love the chance to spread out, but again I DON’T, because it’s rude to everyone else to take up more space than necessary. Get it together, you utter tadpole.

men’s skeletal structure makes their default sitting stance with a wider angle than that of women.

men have balls that, guess what, hurt when crushed. no man sits with his legs so far you can’t possibly sit next to them. no man complains that you’re being rude if you ask him to scoot over a bit. literally no one… except maybe crazy people. like you.

PS I love your tags #mantrum #cissexism. I didn’t know a woman with a vagina could through a mantrum. I suppose you’re throwing a femtrum then huh?

No penis, no opinion.

But let me give you an example from someone with testicles. 

Testicles get incredibly warm and they become like soupy eggs. Unfortunately, they’re still highly sensitive and so they make us spread our legs farther. Especially with how narrow our hips can be, our legs make it uncomfortable to have two sensitive meat sacks hanging where they are.

Having our legs too close to our testicles causes a ton of pinching, uncomfortable rolling, and sitting on, our jewels. Especially when it gets too warm for our pants.

Learn male biology and stop being dumb.

Again, as a person who rides a bus to work every single day and has the courtesy not to sit like a fucking starfish when I have a bus buddy, I don’t give one single, solitary, lonely-ass fuck about your poor sad sensi juevos while you’re on public transportation. It is not a conveyance designed to ensure maximum comfort and ease for your soupy sac. When you’re on a crowded bus, train, or plane, shut the fuck up and adjust your cream of wheat testicle bag such that it rests atop your fucking legs, and my god, please don’t ever, ever, ever, ever assume that I care how your balls feel at ANY time.

Nobody here is telling you to care about my testicles or any man’s testicles, for that matter. Understanding is what is being demanded. A basic understanding of biology is demanded.

Nobody here is talking about crowded buses/ Everyone understands the conservation of space on public transportation.

Stop being bitter and stop being dumb. You’re just sounding like a harpy.

This is like watching an actual slug try to drive a car. Literally your entire argument is about how you should not have to do things that are uncomfortable for you. I’m so embarrassed for you. You should go lie down, but first make sure you dust your soft-serve berry bag with baby powder and wrap in a layer of protective medical gauze to prevent any chafing and–god FORBID–discomfort.

your entire argument is literally just sexism towards men saying that the way they sit is sexist. its the most ridiculous first world non issue its so pathetic you’re whole blog is dedicated to silencing men’s opinions. I bet you think feminism is about equality.

Jesus Christ BALLS ARE NOT BOOBS. Balls rest directly in between the legs and boobs barely even touch your armpits. I’d like to see manslator shove two eggs in their pants and try to keep them from cracking without spreading their legs

Breaking: Area Man’s Lil Wrinkled Beanie Babies Will Crack Just Like Goddamn Eggs If Not Very, Extra Careful

On second thought, shove an entire truck up your sexist ass. Metaphors are to be used subtlety and are not to be taken literally. I honestly don’t understand how people can be this stupid; But, this is tumblr!

My dude. My guy. The thing about metaphors is that they work best when the two things you’re comparing are actually similar. Since no one’s balls have a thin, brittle, easily breakable outer shell, your metaphor is less effective than rubbing toothpaste all over your eyes to prevent cavities.

Pro tip: don’t accuse an English major of not understanding your “subtle” failed ball sac metaphor.

This gets better and better.

So many “explanations” trying to convey why male discomfort is unendurable, and big-strong-tough males can’t handle public transportation bc of their delicate sacs. 

If this were true, why were seats designed (and we know it was probably by MALE engineers) as they are? 

The world caters to male needs.  We KNOW those seats were not designed  primarily with women in mind. Men having testes is not a rare outlier occurrence. 

So logically even other males don’t agree about this. So then, which male morph are we dealing with?  The ‘suck it up buttercup’ big strong male, or the guy who is such a delicate flower he can’t even sit without wincing? You don’t get to be both, Achilles.

And as a side note, men seem to have no idea how uncomfortable much modern office clothing is for women. High heels, bras when you have really large breasts, constricted clothing. Many women are simply used to being uncomfortable most of the time, at least during the work week. Just another thing to deal with, gotta keep moving and deal. So that is part of why we are singularly unimpressed with the ‘discomfort’ argument.

And the thing is, being in public requires acknowledgement of and accomodation to others’ needs as well as one’s own. It’s basic human decency. The core question we are dealing with is: In relation to a big, crowded car of other miserable and uncomfortable human beings with as much right to their bit of measly space as you, where do your testicles fit it? 

The person next to you may be hurting evEN MORE THAN YOU!.  They may be going home from chemo! They might have chronic pain that makes leaning away when their space is encroached on really hard on their back!  They may be feeling suicidal and like no one cares and you just proved it by pushing them into a corner! Or none of these things! They may just be trying to get from point A to point B in the seat that they purchased. All these people are not concerned about your testicles.  

And if your eggs are THAT delicate, the appropriate thing to do is to apologize to the person next to you and explain that you have a handicap condition that makes it impossible to ride in just one seat. Apologize and ask if it is OK.  See, it’s the entitled, ‘I shouldn’t have to explain myself, I’m just going to spread all over the place bc I need space more than other people and they don’t matter so who cares,’ attitude that is the tipoff.  And the butthurt defensive attitude when they are called on their shit. /rant

Just MHO. YMMV. and etc.

As a Fat Person (Not gonna bother revealing gender since I’ve received subtle & overt hate from both women AND men for taking up ‘too much space’ on Airplanes/Mass Transit/tight spaces) I’m kinda finding this whole… -I don’t know, is this a ‘conversation’?-… Fairly amusing. I mean, I’m FULLY aware that fat women receive far more blatant hate for virtually ALL things Fat, than fat men. Yet, BEING FAT, male OR female, while occupying a crowded physical space? Usually gets us vitriol from EVERY quarter no matter HOW accommodating/small/uncomfortable/miserable we end up making OURSELVES so as not to inconvenience others. And, obviously, it’s all OUR fault for showing up in these types of situations/Simply existing, while being fat.

Just another perspective.

This was a surprisingly good read. Anybody know a proper degree of leg spread that would not offend? I’m thinking 30 to 40 degrees would suffice.

@tontonmichel:

I don’t know what it would be in degrees but I’d say a good rule of thumb is the following:

Step 1: Sit down
Step 2: Place hands loosely in lap

Now, sit so that your feet are not wider apart than your shoulders are or at least only a little wider apart than the shoulders are.

grimau-lysikan:

kipplekipple:

manslator:

gh0sst-s:

anti-feminism-pro-equality:

manslator:

krycega:

manslator:

krycega:

anti-feminism-pro-equality:

manslator:

anti-feminism-pro-equality:

manslator:

I think the problem is the ladies of the left, the arbiters of all
reasonable human behavior, have become aware that there are still men
fouling the public arena. And even worse,these men seem to have some
sort of apparatus attached to their buttocks or somewhere down there
that requires these socially unacceptable air thieves to sit with legs
unacceptably akimbo while riding public conveyances.

Manslation: Somebody sat next to me on the bus and made me shift my legs closer together and you just can’t understand the TORTURE this inflicts on my TENDER PARTS. If my legs aren’t splayed wider than the English Channel my grapes will die and shrivel up into lil’ raisins. Also if I pepper this statement with enough big words, it might hide my misogyny.

you: “I am unaware of how biology works and don’t know men’s skeletal structure is designed so that men are more comfortable sitting with their legs wider and I ignore the fact its easier for women to close their legs and I don’t care if a woman puts her bags on the seat next to her but if a mans legs are open that’s MISOGYNY!!!”

feminists are wild

Here’s the thing. It’s already rude to put your bag on a seat when someone needs a place to sit. It is an established social standard. Also, guess what dillweed? It’s more comfortable for women to sit with their legs apart too! But sometimes, when you are on public fucking transport, YOUR COMFORT IS NOT THE PRIORITY. I don’t give two fuckin shits if you are comfortable. I’d love to flush my tampons, but I don’t, because it would be rude to clog other people’s pipes. Most of the time I’m on a crowded bus or train, I would love the chance to spread out, but again I DON’T, because it’s rude to everyone else to take up more space than necessary. Get it together, you utter tadpole.

men’s skeletal structure makes their default sitting stance with a wider angle than that of women.

men have balls that, guess what, hurt when crushed. no man sits with his legs so far you can’t possibly sit next to them. no man complains that you’re being rude if you ask him to scoot over a bit. literally no one… except maybe crazy people. like you.

PS I love your tags #mantrum #cissexism. I didn’t know a woman with a vagina could through a mantrum. I suppose you’re throwing a femtrum then huh?

No penis, no opinion.

But let me give you an example from someone with testicles. 

Testicles get incredibly warm and they become like soupy eggs. Unfortunately, they’re still highly sensitive and so they make us spread our legs farther. Especially with how narrow our hips can be, our legs make it uncomfortable to have two sensitive meat sacks hanging where they are.

Having our legs too close to our testicles causes a ton of pinching, uncomfortable rolling, and sitting on, our jewels. Especially when it gets too warm for our pants.

Learn male biology and stop being dumb.

Again, as a person who rides a bus to work every single day and has the courtesy not to sit like a fucking starfish when I have a bus buddy, I don’t give one single, solitary, lonely-ass fuck about your poor sad sensi juevos while you’re on public transportation. It is not a conveyance designed to ensure maximum comfort and ease for your soupy sac. When you’re on a crowded bus, train, or plane, shut the fuck up and adjust your cream of wheat testicle bag such that it rests atop your fucking legs, and my god, please don’t ever, ever, ever, ever assume that I care how your balls feel at ANY time.

Nobody here is telling you to care about my testicles or any man’s testicles, for that matter. Understanding is what is being demanded. A basic understanding of biology is demanded.

Nobody here is talking about crowded buses/ Everyone understands the conservation of space on public transportation.

Stop being bitter and stop being dumb. You’re just sounding like a harpy.

This is like watching an actual slug try to drive a car. Literally your entire argument is about how you should not have to do things that are uncomfortable for you. I’m so embarrassed for you. You should go lie down, but first make sure you dust your soft-serve berry bag with baby powder and wrap in a layer of protective medical gauze to prevent any chafing and–god FORBID–discomfort.

your entire argument is literally just sexism towards men saying that the way they sit is sexist. its the most ridiculous first world non issue its so pathetic you’re whole blog is dedicated to silencing men’s opinions. I bet you think feminism is about equality.

Jesus Christ BALLS ARE NOT BOOBS. Balls rest directly in between the legs and boobs barely even touch your armpits. I’d like to see manslator shove two eggs in their pants and try to keep them from cracking without spreading their legs

Breaking: Area Man’s Lil Wrinkled Beanie Babies Will Crack Just Like Goddamn Eggs If Not Very, Extra Careful

I’m on mobile, will someone fgs start adding some pictures?

And as someone who spent 2 years on public transport for 4 hours a day, YES there are plenty of men who still manspread on crowded transportation. And there are also plenty of men who manage to live without manspreading without crushing their testes.

Stop acting like no one has ever met a man before jfc you’re not a super rare Pokémon YOU HAVEN’T BEEN INVISIBLE ALL THIS TIME.

As a 60 year old man who sits in an office chair 8-12 hours a day I have to call bullshit. My balls do not hurt, and never have, from keeping my legs closed.
When I was in the Air Force at 18 years old we were not allowed to sit with our legs spread – it was considered unprofessional and reflected badly on the military.
When I was 22 in college professors would stop class to tell students who sat with their legs spread that advertising their availability was not appropriate for a classroom setting.
As an old man who is not given space at all by younger people, I need to keep my injured legs together for fear of more damage from their book bags and other accessories that they think are more important than an old man’s comfort.
I still managed to sire three strong boys who don’t sit with their legs spread as if hoping some girl will fall on them and want to have sex at that moment.
Your biological shit excuses are just shit excuses for being rude and taking up as much space as you can get away with just for the attention you think it gets you.

The attention you are getting is not the admiration you think it is. It is disgust for your lack of social etiquette.

Grow up. 

Plus, I’m not asking for you (i.e. men) to sit with your knees clamped together or anything – shoulder width apart is fine.

I’m Sorry

grimau-lysikan:

My generation has failed yours.

I’m old. I only voted because it was easy (absentee ballot for being out of state at the time). I would have skipped if I had to go to a polling station. I’m old and it’s not easy to get around.

Many of the people in my age group skipped. There wasn’t any real point to voting this time. No sane person would vote Republican. It was an easy win for the Democrats all around. The effort to vote wasn’t worth it for such an easy win. A Republican posing as a Democrat to counter a hate mongering fascist – she’d win even with the misogynists.

We didn’t count on the hidden hatreds. The quiet bigots.

We didn’t turn out to vote because we didn’t think you needed us. We failed you.

flyingfluffywolf:

butterflyinthewell:

I will always side-eye NT parents who are okay with electric shock devices being used on their autistic kids.

Their argument is always: “They let me try it, and it felt like a little pinch!”

They have an NT nervous system.

An autistic person’s nervous system can turn that “little pinch” into feeling like they’re burning alive (difficulty or inability to localize pain) or having their limb sawed off (hypersensitivity).

Why do you think some autistic people will go into brutal self-injurious meltdowns over a little cut on their toe or a tiny canker sore in their mouth?

When I was a kid, I gave myself a “little” shock trying to pry a plug out of a socket with a paper clip. I was 4 and didn’t know metal conducted electricity. I thought my arm was on fire, and all I had was a tiny burn on one finger. But I was in so much pain that I screamed for hours. That was technically a bigger shock than the people who get zapped as an aversive get, but my nervous system flipped out and forgot to turn off the alarm system (pain) for 3 hours. It was so traumatic for me that I wouldn’t touch cords or plugs for years as a kid. (Now I can and do all the time– very carefully and without paperclips!)

My point is: The zappy thing is a little pinch to you. It’s not a little pinch to autistic people.

It’s torture, and it’s traumatic.

To be completely fucking honest it’s just inhumane to use electric shock devices on CHILDREN anyway! I thought I would only read that in dystopian books, not in real life! What the fuck!!

ladiesloveduranduran:

ladiesloveduranduran:

Calico cats who have grey fur instead of black are VALID

Take a look at some of these valid ladies:

Gorgeous.  Magnificent.

A deep thinking gal.  I love her.

A baby.  And yet still deeply valid.

@ladiesloveduranduran

Yeah, these are what we call dilute calicos or light calicos.    Genetically speaking, they are calicos – just ones that are homozygous recessive for the dilution gene.   See how the top cat has some silver in her coat and how the orange in these calicos is more of a gold?   Those are the hints though the gold is the giveaway.      

They can also be called muted calicos:  https://pets.thenest.com/muted-calico-cat-5423.html

They’re really interesting because in order to get these valid ladies, you need:

–  

XBXb

 i.e. tortoiseshell genes
-At least one S allele for piebalding
-Two recessive dilution genes

By the way, since tortiseshell and its cousin calico (Energetically speaking, calicos are just torties with a piebalding gene) are caused by X inactivation – you can’t clone a calico pattern.

deepspacepirate:

deepspacepirate:

monkeysky:

intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

You got like six unique nucleotides so nice

OP is a virus from outer space

FUCK YOU OP